View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_16 (Length: 271)
Name: NF0029_low_16
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 33 - 261
Target Start/End: Original strand, 51252672 - 51252900
Alignment:
| Q |
33 |
tatactataacctttcttatcttctctctgtactccttgagcttccaaaaatcataaaaggcgaaacccaattgaggaatggaagggttaacagggctta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51252672 |
tatactataacctttcttatcttctctctgtactccttcagcttccaaaaatcataaaaggcgaaacccaattgaggaatggaagggttaacagggctta |
51252771 |
T |
 |
| Q |
133 |
gtcacctatttgtgacaatgtttctagcagggtttggaggaattatagttatgccttcaataacagatgtcaccatggctgcactttgtcctggtcaaga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51252772 |
gtcacctatttgtgacaatgtttctagcagggtttggaggaattatagttatgccttcaataacagatgtcaccatggctgcactttgtcctggtcaaga |
51252871 |
T |
 |
| Q |
233 |
tgaatgctctcttgccatttacctctctg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51252872 |
tgaatgctctcttgccatttacctctctg |
51252900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University