View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_17 (Length: 271)
Name: NF0029_low_17
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 223
Target Start/End: Original strand, 4089467 - 4089654
Alignment:
| Q |
36 |
gaactgcacatgtgttgaattattattgttaacaaaatttgtaacaactatagtttttacaattttctccaccaaactttgttaatatttttcttataaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4089467 |
gaactgcacatgtgttgaattattattgttaacaaaatttgtaacaactatagtttttacaattttctctaccaaactttgttaatatttttcttataaa |
4089566 |
T |
 |
| Q |
136 |
taaaagacatgacaatacttaatgatcaataaagaatagtttccgaaccaaccctacacgaaagataatgtactattatgaaattgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4089567 |
taaaagacatgacaatacttaatgatcaataaagaatagtttccgaaccaaccctacacgaaagataatgtactattatgaaattgtt |
4089654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University