View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_18 (Length: 267)
Name: NF0029_low_18
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0029_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 48183244 - 48183476
Alignment:
Q |
11 |
aataaatgatgtctaaactctaaacattgatttgaaaaagagagagagataagagtagtagtcgaacaataccgattctgacatgtagcgaccgatgtgg |
110 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48183244 |
aataaatgatgtctaaactctaaacattgagttgaaagagagagagagataagagtagtagtcgaacaataccgattctgacatgtagcgaccgatgtgg |
48183343 |
T |
 |
Q |
111 |
tttttgtgcatcctagaaatgtaacacagtgcgtgaagtggcggtggaccacatggtgattggcgtgcgactttacacatagatatcgacattcacgtgg |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
48183344 |
tttttgtgcatcctagaaatgtaacacagtgcgtgaagtggcggtggaccacatggtgattggcatgcgactttacacatagatatcgacattcacgtgg |
48183443 |
T |
 |
Q |
211 |
atttgctccatttcttcccttcctactatgatg |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
48183444 |
atttgctccatttcttcccttcctactatgatg |
48183476 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University