View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_19 (Length: 251)
Name: NF0029_low_19
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 32 - 222
Target Start/End: Original strand, 39397226 - 39397416
Alignment:
| Q |
32 |
agactctattcccatattaatgatattcacaccatattttgcttcaagaacctctttccaaagtgcattctcactttgcagcaatctccaccgccatttc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39397226 |
agactctattcccatattaatgatattcacaccatattttgcttcaagaacctctttccaaagtgcattctcactttgcagcaatctccaccgccatttc |
39397325 |
T |
|
| Q |
132 |
accaaaaggctcaaattcaccaaccccaaatctctcaccccaagacctctcttattgtggagaagacacgccgtttttcatctcactcgac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
39397326 |
accaaaaggctcaaattcaccaaccccaaatctctcaccccaagacctctcttattgtggagaagacacgctgttttccatctcacccgac |
39397416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 745 times since January 2019
Visitors: 1105