View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_9 (Length: 314)
Name: NF0029_low_9
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 25739462 - 25739540
Alignment:
| Q |
149 |
caactatatttttgtaaattgatgttatatgtgtccaacatcgtaggtatgtttaagattgttgtttgtgtgttaaagt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25739462 |
caactatatttttgtaaattgatgttatatatgtccaacatcgtaggtatgtttaaggttgttgtttgtgtgttaaagt |
25739540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 180 - 231
Target Start/End: Original strand, 25743099 - 25743150
Alignment:
| Q |
180 |
tgtccaacatcgtaggtatgtttaagattgttgtttgtgtgttaaagttcat |
231 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
25743099 |
tgtccaacatcttaggtatgtttaaggttgttgtttgtgtgttcaagttcat |
25743150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University