View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0033-Insertion-10 (Length: 204)

Name: NF0033-Insertion-10
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0033-Insertion-10
NF0033-Insertion-10
[»] chr7 (2 HSPs)
chr7 (106-204)||(43329520-43329618)
chr7 (6-35)||(43329420-43329449)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 106 - 204
Target Start/End: Original strand, 43329520 - 43329618
Alignment:
106 tgagtgagtacaaacaaatattaatggnnnnnnnntgattcaccaatgagatttagttttcatgcatatatcaaaagaggaccttccaccttcatttag 204  Q
    |||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43329520 tgagtgagtacaaacaaatattaatggaaaaaaaatgattcaccaatgagatttagttttcatgcatatatcaaaagaggaccttccaccttcatttag 43329618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 35
Target Start/End: Original strand, 43329420 - 43329449
Alignment:
6 cattagattggagccatgtcggtataatat 35  Q
    ||||||||||||||||||||||||||||||    
43329420 cattagattggagccatgtcggtataatat 43329449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 588 times since January 2019
Visitors: 1099