View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0033-Insertion-11 (Length: 150)

Name: NF0033-Insertion-11
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0033-Insertion-11
NF0033-Insertion-11
[»] scaffold0140 (1 HSPs)
scaffold0140 (34-150)||(36930-37046)


Alignment Details
Target: scaffold0140 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 34 - 150
Target Start/End: Original strand, 36930 - 37046
Alignment:
34 gtgtcctccccatcagttccttttgcttggttgttcttctgaatattctcattccaattcactagacctgtcaccaactcccttgtaaccttctctagtt 133  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||    
36930 gtgtccttcccatcagttccttttgcttggttgttcttctgaatattctcattccaattcactagacctgtgaccaactcccttgtaaccttttctagtt 37029  T
134 cctctggtggaagcatc 150  Q
    |||||||||||||||||    
37030 cctctggtggaagcatc 37046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University