View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0033-Insertion-11 (Length: 150)
Name: NF0033-Insertion-11
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0033-Insertion-11 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0140 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 34 - 150
Target Start/End: Original strand, 36930 - 37046
Alignment:
| Q |
34 |
gtgtcctccccatcagttccttttgcttggttgttcttctgaatattctcattccaattcactagacctgtcaccaactcccttgtaaccttctctagtt |
133 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36930 |
gtgtccttcccatcagttccttttgcttggttgttcttctgaatattctcattccaattcactagacctgtgaccaactcccttgtaaccttttctagtt |
37029 |
T |
|
| Q |
134 |
cctctggtggaagcatc |
150 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37030 |
cctctggtggaagcatc |
37046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 651 times since January 2019
Visitors: 1100