View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0033_high_17 (Length: 225)
Name: NF0033_high_17
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0033_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 22234679 - 22234823
Alignment:
| Q |
1 |
caatttgcttctttttctccttttaagcaattggagataccaaactatgatcttcagcctcagatcttttgcagggttgtcaatgtccaactacttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22234679 |
caatttgcttctttttctccttttaagcaattggagataccaaactatgatcttcagcctcagatcttttgcagggttgtcaatgtccaactacttgtaa |
22234778 |
T |
|
| Q |
101 |
gtactcaattatactctttgaattaactattagtgtttacctatg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22234779 |
gtactcaattatactctttgaattaactattagtgtttacctatg |
22234823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 819 times since January 2019
Visitors: 1110