View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0033_low_13 (Length: 320)
Name: NF0033_low_13
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0033_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 87 - 320
Target Start/End: Complemental strand, 42399703 - 42399470
Alignment:
| Q |
87 |
acatagccatctgaacttctttctccttgaaaccacatttctcatagaaaaccttgttctcgacactgcaatcgagaatcaccttataacacccaaccga |
186 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42399703 |
acatagccatctcaacttctttctccttgaaaccacatttctcatagaaaaccttattctcgacactgcaatcgagaatcaccttataacacccaaccga |
42399604 |
T |
|
| Q |
187 |
acgagcatgatcggtaagaaagttaattactttcttccccaattgtttcccacgagcacttgaatccacaacaacatcttctatatgtccaactttacca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42399603 |
acgagcatgatcggtaagaaagttaattactttcttccccaattgtttcccacgagcacttgaatccacaacaacatcttctatatgtccaactttacca |
42399504 |
T |
|
| Q |
287 |
caatttctcaaaaatttcttctcaataaacacac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42399503 |
caatttctcaaaaatttcttctcaataaacacac |
42399470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 818 times since January 2019
Visitors: 1110