View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0033_low_18 (Length: 277)
Name: NF0033_low_18
Description: NF0033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0033_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 55 - 253
Target Start/End: Complemental strand, 2831666 - 2831473
Alignment:
| Q |
55 |
cacatccaagctcgtgagcaat--tgagcatctttatttgtcacttttgaagcaaacaaatgaagcatgaccataattggtcccccttcgtttattattt |
152 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2831666 |
cacatccaagctcgtgagcaatattgagcatctttatttgtcacttttgaagcaaacaaatgaagcatgaccataattggtcccccttcttttat----- |
2831572 |
T |
|
| Q |
153 |
ttgatcattgttataagtatgtctgctaagtttataacttaattttgtttttagggaagcttataacttaaaaattggttcctttcaaaatacaattatt |
252 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2831571 |
--gatcattgttatgagtatgtctgctaagcttataacttaattttgtttttagggaagcttataacttaaaaattggttcctttcaaaatacaattatt |
2831474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 881 times since January 2019
Visitors: 1111