View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0034_high_3 (Length: 335)
Name: NF0034_high_3
Description: NF0034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0034_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 9799740 - 9799512
Alignment:
Q |
30 |
agaaattttggtacaaataagaagaagataattgtcactgtgaaagtggacacaacaaaacaatcttgtgagttcatacaaaagaaacacgaacatcttg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9799740 |
agaaattttggtacaaataagaagaagataattgtcactgtgaaagtggacacaacaaaacaatcttgtgagttcatacaaaagaaacacgaacatcttg |
9799641 |
T |
 |
Q |
130 |
tgatggtgtgagtttcattatttcttgactttggttgctctctatgtccatttgtatagtggattgatgtggaagtgggtatgattcttaaatagaaagc |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9799640 |
tgatggtgtgagtttcattatttcttgactttggtttctctttatgtccatttgtatagtggattgatgtggaagtgggtatgattcttaaatagaaagc |
9799541 |
T |
 |
Q |
230 |
caccactctcatagtgaaatgatgatgtc |
258 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
9799540 |
caccactctcatagtgaaatgatgatgtc |
9799512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University