View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0034_low_6 (Length: 225)
Name: NF0034_low_6
Description: NF0034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0034_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 54268062 - 54268208
Alignment:
| Q |
1 |
acaccttttctttcacaaaataaaatacgtacgtacatatgaacactagataatgtacgtataaatgctcgtatggtgcgtaaaatgttctttactacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268062 |
acaccttttctttcacaaaataaaatacgtacgtacatatgaacactag-tgatgtacgtataaatgctcgtatggtgcgtaaaatgttctttactacta |
54268160 |
T |
|
| Q |
101 |
taattatgactagtagttaagtagctagccaggtacaacaatctaaat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268161 |
taattatgactagtagttaagtagctagccaggtacaacaatctaaat |
54268208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 835 times since January 2019
Visitors: 1110