View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0034_low_6 (Length: 225)

Name: NF0034_low_6
Description: NF0034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0034_low_6
NF0034_low_6
[»] chr4 (1 HSPs)
chr4 (1-148)||(54268062-54268208)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 54268062 - 54268208
Alignment:
1 acaccttttctttcacaaaataaaatacgtacgtacatatgaacactagataatgtacgtataaatgctcgtatggtgcgtaaaatgttctttactacta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
54268062 acaccttttctttcacaaaataaaatacgtacgtacatatgaacactag-tgatgtacgtataaatgctcgtatggtgcgtaaaatgttctttactacta 54268160  T
101 taattatgactagtagttaagtagctagccaggtacaacaatctaaat 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
54268161 taattatgactagtagttaagtagctagccaggtacaacaatctaaat 54268208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University