View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0042_high_5 (Length: 209)
Name: NF0042_high_5
Description: NF0042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0042_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 22 - 184
Target Start/End: Complemental strand, 51919241 - 51919079
Alignment:
Q |
22 |
caaataatacatgcatcacttagtttattgagctaaaaacccgtgaatatgcatcgtacgtataccgagacaaaatataaaatgtgggggatgcaaatta |
121 |
Q |
|
|
||||||| ||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51919241 |
caaataagacacgcatcacttagtctattgagctaaaaacccgtgaacatgcatcgtacgtataccgagacaaaatataaaatgtgggggatgcaaatta |
51919142 |
T |
 |
Q |
122 |
caatttgaataaattgttgcactctatacaattgggtttattatccataaactattatgtata |
184 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
51919141 |
caatttgaataaattgttgcactctatacaattgggtttattatccataaattattatgtata |
51919079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 689 times since January 2019
Visitors: 1103