View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0042_low_8 (Length: 209)

Name: NF0042_low_8
Description: NF0042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0042_low_8
NF0042_low_8
[»] chr4 (1 HSPs)
chr4 (22-184)||(51919079-51919241)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 22 - 184
Target Start/End: Complemental strand, 51919241 - 51919079
Alignment:
22 caaataatacatgcatcacttagtttattgagctaaaaacccgtgaatatgcatcgtacgtataccgagacaaaatataaaatgtgggggatgcaaatta 121  Q
    ||||||| ||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
51919241 caaataagacacgcatcacttagtctattgagctaaaaacccgtgaacatgcatcgtacgtataccgagacaaaatataaaatgtgggggatgcaaatta 51919142  T
122 caatttgaataaattgttgcactctatacaattgggtttattatccataaactattatgtata 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
51919141 caatttgaataaattgttgcactctatacaattgggtttattatccataaattattatgtata 51919079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University