View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_high_7 (Length: 314)
Name: NF0043_high_7
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0043_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 13907976 - 13908195
Alignment:
Q |
1 |
aaaatatgcatatgtgtatgttatatatgtgaacacttacatggcttaaacggatatgaagtggattaggtttgaagaatcacgaaatatgacaaaac-- |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
13907976 |
aaaatatgcatatgtgtatgttatatatgtgaacagtgacatgacttaaacggatatgaagtggattagatttgaagaatcacgaaatatgacaaaacac |
13908075 |
T |
 |
Q |
99 |
tggaagaaaattctatggtgcagaaatttgtggtaagttaatgtgttttaagtttctaaagtcaaatgttttttaactgtatgttccttgatgtaatttg |
198 |
Q |
|
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
13908076 |
tggaagaaaattctagggtgtagaaatttgtggtaagttaatgtgttttaagtttctaaagtcaaatgttttttgactgtatgttccttgatgtaatttg |
13908175 |
T |
 |
Q |
199 |
tgtgaatctgcagtgcccta |
218 |
Q |
|
|
||||||| || ||||||||| |
|
|
T |
13908176 |
tgtgaatatgtagtgcccta |
13908195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 834 times since January 2019
Visitors: 1110