View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_high_8 (Length: 258)
Name: NF0043_high_8
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0043_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 29 - 247
Target Start/End: Complemental strand, 41747310 - 41747095
Alignment:
| Q |
29 |
atgacttgccacccaaatcaaatcaaaatcaaaattgctataatttctcctaaagacttgttcaattcgattttatttaggaactaataaaatgtgagta |
128 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41747310 |
atgacttgccacccaaatcaaataaaaatcaaaattgctataatttctcctaaagacttgttcaattcaattttatttaggaactaataaaatgtgagta |
41747211 |
T |
|
| Q |
129 |
tgagtctgcatctgcatgtaccgtaattgtgagggagtaaga---gatgatattattacgtggaatctgtctgttttatagg---attcaataacggaac |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41747210 |
tgagtctgcatctgcat---------ttgtgagggagtaagagatgatgatattattacgtggaatctgtctgttttataggaatattcaataacggaac |
41747120 |
T |
|
| Q |
223 |
ggataatcttcttcttattgttcat |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41747119 |
ggataatcttcttcttattgttcat |
41747095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 600 times since January 2019
Visitors: 1099