View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_low_1 (Length: 482)
Name: NF0043_low_1
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0043_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 334; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 8 - 365
Target Start/End: Complemental strand, 33791189 - 33790832
Alignment:
| Q |
8 |
agatggacatcatcaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgcta |
107 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33791189 |
agatgtacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgcta |
33791090 |
T |
|
| Q |
108 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791089 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
33790990 |
T |
|
| Q |
208 |
tcttgctgctttctctgattcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaaatcaaccaaattggtcatgacaaaata |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33790989 |
tcttgctgctttctctgattcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaaatcaaccaaattggtcatgacaaaata |
33790890 |
T |
|
| Q |
308 |
ttttatattttggtaagtatacgtgtagagtaagataaatatgcagcttcctaaaaat |
365 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33790889 |
ttgtatattttggtaagtatatgtgtagagtaagataaatatgcagctgcctaaaaat |
33790832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 34 - 148
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
| Q |
34 |
taatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
133 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| ||||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
| T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
|
| Q |
134 |
gttgatggacatgca |
148 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33764198 |
gttgatggacatgca |
33764212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 712 times since January 2019
Visitors: 1103