View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_low_13 (Length: 263)
Name: NF0043_low_13
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0043_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 36767183 - 36766972
Alignment:
| Q |
21 |
gaacacatgttgaatcatttagtgtttactattaagaggacacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctc |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767183 |
gaacacatgttggatcatttagtgtttactattagtaggacacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctc |
36767084 |
T |
|
| Q |
121 |
aatttttcattgtgctactactaacagatggacaaagttactgttcttggagatgctatcaagtacttgaagaaattgcaagagaaggtgaaggttcttg |
220 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767083 |
agtttttcattgtgctactactaacagatggacaaagttactgttcttggagatgctatcaagtacttgaagaaattgcaagagaaggtgaaggttcttg |
36766984 |
T |
|
| Q |
221 |
tggaggagcaga |
232 |
Q |
| |
|
|||||| |||| |
|
|
| T |
36766983 |
aggaggaacaga |
36766972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 232
Target Start/End: Original strand, 2377461 - 2377549
Alignment:
| Q |
144 |
acagatggacaaagttactgttcttggagatgctatcaagtacttgaagaaattgcaagagaaggtgaaggttcttgtggaggagcaga |
232 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||| | |||||| ||| || || ||||||| |||| ||||||| |||||| |||| |
|
|
| T |
2377461 |
acagatggacaaagcttctgttcttggagaagctataaggtacttaaagcaaatggaagagaaagtgagtgttcttgaggaggaacaga |
2377549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 229 - 263
Target Start/End: Original strand, 26519553 - 26519587
Alignment:
| Q |
229 |
cagagacatggccgagcgaatatattgcgacggtt |
263 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26519553 |
cagagacatggccgaccgaatatattgcgacggtt |
26519587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 808 times since January 2019
Visitors: 1110