View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0043_low_14 (Length: 258)

Name: NF0043_low_14
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0043_low_14
NF0043_low_14
[»] chr8 (1 HSPs)
chr8 (29-247)||(41747095-41747310)


Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 29 - 247
Target Start/End: Complemental strand, 41747310 - 41747095
Alignment:
29 atgacttgccacccaaatcaaatcaaaatcaaaattgctataatttctcctaaagacttgttcaattcgattttatttaggaactaataaaatgtgagta 128  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
41747310 atgacttgccacccaaatcaaataaaaatcaaaattgctataatttctcctaaagacttgttcaattcaattttatttaggaactaataaaatgtgagta 41747211  T
129 tgagtctgcatctgcatgtaccgtaattgtgagggagtaaga---gatgatattattacgtggaatctgtctgttttatagg---attcaataacggaac 222  Q
    |||||||||||||||||         ||||||||||||||||   |||||||||||||||||||||||||||||||||||||   |||||||||||||||    
41747210 tgagtctgcatctgcat---------ttgtgagggagtaagagatgatgatattattacgtggaatctgtctgttttataggaatattcaataacggaac 41747120  T
223 ggataatcttcttcttattgttcat 247  Q
    |||||||||||||||||||||||||    
41747119 ggataatcttcttcttattgttcat 41747095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 820 times since January 2019
Visitors: 1110