View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_low_17 (Length: 206)
Name: NF0043_low_17
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0043_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 14068093 - 14068260
Alignment:
| Q |
1 |
ttcaaaaaataacctcatctgattggaaccattcataataaggaggatcgaaaatgccttcaacatctgattttccttgtgctggaaatggaccatcgag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14068093 |
ttcaaaaaataacctcatttgattggaaccattcataataaggaggatcgaaaatgccttcaacatctgattttccttgtgctggaaatggaccatcgag |
14068192 |
T |
 |
| Q |
101 |
gaaaacgaggtccaatttttgtattacagtttcaggccaacgtaaaactagtttcttgaggatttcac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14068193 |
gaaaacgaggtccaatttttgtattacagtttcaggccaacgtaaaactagtttcttgaggatttcac |
14068260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 73
Target Start/End: Complemental strand, 27574094 - 27574045
Alignment:
| Q |
24 |
tggaaccattcataataaggaggatcgaaaatgccttcaacatctgattt |
73 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
27574094 |
tggaaccactcataataaggagggtcgaaaattccttcaacatcagattt |
27574045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 73
Target Start/End: Complemental strand, 13118851 - 13118803
Alignment:
| Q |
25 |
ggaaccattcataataaggaggatcgaaaatgccttcaacatctgattt |
73 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
13118851 |
ggaaccactcataataaggagggtcgaaaatgtcttcaacatcagattt |
13118803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University