View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0043_low_2 (Length: 479)
Name: NF0043_low_2
Description: NF0043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0043_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 206 - 345
Target Start/End: Complemental strand, 44667680 - 44667541
Alignment:
| Q |
206 |
aatgataaattgtagagtgtggtgagtgatgaggggatataagaaaaataatggcagtagttaattggtggtggatgttaagtatgagcttctagatttt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44667680 |
aatgataaattgtagagtgtggtgagtgatgaggggataaaagaaaaataatggcagtagttaattggtggtggatgttaagtatgaggttctagatttt |
44667581 |
T |
 |
| Q |
306 |
tctgatgtgattgatgagaatgaagaggatgaaagatttg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44667580 |
tctgatgtgattgatgagaatgaagaggatgaaagatttg |
44667541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 38 - 169
Target Start/End: Complemental strand, 44667840 - 44667719
Alignment:
| Q |
38 |
cctgtgagagagaagtcatttgttgaagaaaaagaaggattgaattgagttgagttgacttgattagaaaggaagaagagttgtatagatatatagaggt |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44667840 |
cctgtgaaagagaagtcatttgttgaagaaaaagaaggattgaattgagttgact----------agaaaggaagaagagttgtatagatatatagaggt |
44667751 |
T |
 |
| Q |
138 |
gggtgtaggtgagattgcttaatggaagatat |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
44667750 |
gggtgtaggtgagattgcttaatgggagatat |
44667719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University