View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0047_high_6 (Length: 270)
Name: NF0047_high_6
Description: NF0047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0047_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 42 - 250
Target Start/End: Original strand, 6734759 - 6734967
Alignment:
| Q |
42 |
cttcatgcatgatatccttggtggatcacatccatcagcaagagtagtagcaggaattgtagcaaacagtgatgtaaccggcttaccattctccaagctc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6734759 |
cttcatgcatgatatccttggtggatcacatccatcagcaagagtggtagcaggaattgtagcaaacagtgatgtaaccggcttaccattctccaagctc |
6734858 |
T |
|
| Q |
142 |
aacaacaatctcttccctattactggaggaattccattagttaaccctaaactcaatggcattgtcacaaacaacaatctcccaaaccttgtaggtctct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6734859 |
aacaacaatctcttccctattactggaggaattccattagttaaccctaaactcaatggcattgtcacaaacaacaatctcccaaaccttgtaggtctca |
6734958 |
T |
|
| Q |
242 |
gtgctgctc |
250 |
Q |
| |
|
||||||||| |
|
|
| T |
6734959 |
gtgctgctc |
6734967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 42 - 218
Target Start/End: Complemental strand, 52200286 - 52200110
Alignment:
| Q |
42 |
cttcatgcatgatatccttggtggatcacatccatcagcaagagtagtagcaggaattgtagcaaacagtgatgtaaccggcttaccattctccaagctc |
141 |
Q |
| |
|
||||||||||||||| || ||||| ||||| |||||||||||||||||| | ||||| |||||||||||||||||||| |||||||| |||||||| | |
|
|
| T |
52200286 |
cttcatgcatgatatactaggtgggtcacacccatcagcaagagtagtaaccggaatagtagcaaacagtgatgtaacaggcttacccttctccaaaaac |
52200187 |
T |
|
| Q |
142 |
aacaacaatctcttccctattactggaggaattccattagttaaccctaaactcaatggcattgtcacaaacaacaa |
218 |
Q |
| |
|
|||||||| ||||||| || || |||||||| || ||||| | ||| || ||||||||||| ||||||||||||| |
|
|
| T |
52200186 |
aacaacaacatcttcccaatcacaggaggaatacccttagtcatccccaagctcaatggcatcatcacaaacaacaa |
52200110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 783 times since January 2019
Visitors: 1108