View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0047_low_12 (Length: 262)
Name: NF0047_low_12
Description: NF0047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0047_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 2 - 233
Target Start/End: Original strand, 43194788 - 43195022
Alignment:
| Q |
2 |
agcaaggacttggtcacattgtcaggtgcaattgcattgatttggacgataagcctatgnnnnnnn---acttatatttaattcaaatatataatttcac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
43194788 |
agcaaggacttggtcacattgtcaggtgcaattgcattgatttggacgataagcctatgttttttttttacttatatttagttcaaatatataatttcac |
43194887 |
T |
|
| Q |
99 |
aattgggaagagcacataattttcaaataattaatttggtgtgttaattaattgactaggtgctcacacaattggacaagcaagatgcacaacctttagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43194888 |
aattgggaagagcacataattttcaaataattaatttggtgtcttaattaattgattaggtgctcacacaattggacaagcaaggtgcacaacctttagg |
43194987 |
T |
|
| Q |
199 |
gcacgaatctacaatgagaccaacatagatacttc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194988 |
gcacgaatctacaatgagaccaacatagatacttc |
43195022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 88 - 234
Target Start/End: Original strand, 43189847 - 43189993
Alignment:
| Q |
88 |
tataatttcacaattgggaagagcacataattttcaaataattaatttggtgtgttaattaattgactaggtgctcacacaattggacaagcaagatgca |
187 |
Q |
| |
|
||||||||| ||| |||||||| | |||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43189847 |
tataatttctcaactgggaagaactaataattgtcaaataactaatttggtgtcttaattaattgactaggtgctcacacaattggacaagcaaggtgca |
43189946 |
T |
|
| Q |
188 |
caacctttagggcacgaatctacaatgagaccaacatagatacttct |
234 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43189947 |
caacatttagggtacgaatctacaatgagaccaacatagatacttct |
43189993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 125 - 225
Target Start/End: Original strand, 43180559 - 43180659
Alignment:
| Q |
125 |
ataattaatttggtgtgttaattaattgactaggtgctcacacaattggacaagcaagatgcacaacctttagggcacgaatctacaatgagaccaacat |
224 |
Q |
| |
|
||||||||||||| || |||||||||||| |||||| |||||||||||||||||||| || |||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
43180559 |
ataattaatttggagtcttaattaattgaacaggtgcacacacaattggacaagcaaggtgtacaaattttagggcacgaatctacaacgagaccaacat |
43180658 |
T |
|
| Q |
225 |
a |
225 |
Q |
| |
|
| |
|
|
| T |
43180659 |
a |
43180659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 233
Target Start/End: Original strand, 36190996 - 36191077
Alignment:
| Q |
152 |
gactaggtgctcacacaattggacaagcaagatgcacaacctttagggcacgaatctacaatgagaccaacatagatacttc |
233 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| || ||||| || | || ||||| || |||||||||||||||| |
|
|
| T |
36190996 |
gactagggggtcacacaattggacaagcaaggtgcactacatttagagcccacatttacaacgactccaacatagatacttc |
36191077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 723 times since January 2019
Visitors: 1105