View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0047_low_16 (Length: 247)
Name: NF0047_low_16
Description: NF0047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0047_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 48656912 - 48656689
Alignment:
| Q |
23 |
tcactcatcactcactagctacaccttccaagattagannnnnnnngtggttgtatacattaccatttccattttcaatgcaaaatgcaaatgtctcaat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48656912 |
tcactcatcactcactagctacaccttccaacattagattttttt-gtggttgtatacattaccatttccattttcaatgcaaaatgcaaatgtctcaat |
48656814 |
T |
 |
| Q |
123 |
ttttattggcgccgcaccttccaacattagatttgcagagaggacaaacaaagaaagaccgttggcttccaactacttttcaaaacttacctcaaaatct |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48656813 |
ttttattggcaccgcaccttccaacattagatttgcagagaggacaaacaaagaaagaccgttggcttccaactacttttcaaaacttacctcaaaatct |
48656714 |
T |
 |
| Q |
223 |
aaccttcttcaacttctactactag |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48656713 |
aaccttcttcaacttctactactag |
48656689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University