View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0047_low_5 (Length: 306)
Name: NF0047_low_5
Description: NF0047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0047_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 174 - 254
Target Start/End: Complemental strand, 35629042 - 35628961
Alignment:
| Q |
174 |
gtactgtactatctcttccttcatagtttgacttacagatgttaaatcaatattgtgc-atatgatgtcaattaatatgaat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35629042 |
gtactgtactatctcttccttcatagtttgacttacatatgttaaatcaatattgtgcaatatgatgtcaattaatatgaat |
35628961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 16 - 107
Target Start/End: Complemental strand, 35629205 - 35629109
Alignment:
| Q |
16 |
atgacagttggaagtgacaatgtattgtccttctatagttcttttgttttcttcttaatttcaaata-----atccgtatctgtttacgtgatagtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
35629205 |
atgacagttggaagtgacaatgtattgtccttctataattcttttgttttcttcttaatttcaaataatccaatccgtatcagtttacgtgatagtg |
35629109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 277
Target Start/End: Complemental strand, 35628775 - 35628745
Alignment:
| Q |
247 |
atatgaatttgagtttggagagtactgacaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35628775 |
atatgaatttgagtttggagagtactgacaa |
35628745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 664 times since January 2019
Visitors: 1100