View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0048_high_3 (Length: 258)
Name: NF0048_high_3
Description: NF0048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0048_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 36002614 - 36002405
Alignment:
| Q |
17 |
agatgaacagaaagtgggtgataagagaaattttccaaaataaaaaggagaaaatacgaatatttggggactaaccaaaactcaaagtaaacaatcaagg |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
36002614 |
agatcaacagaaagtgggtgataagagaaattttccaaaataaaaaggagaaaatacaaatattgggggactaaccaaaactcaaagtaaacaatcaaag |
36002515 |
T |
|
| Q |
117 |
gcataaacatcgtatgcctcgttaaagaccttatcaaggaaatccaatcagatgaaatctgatgaa-gaaaaaagagtgcataacgaacaaaagactgaa |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36002514 |
gcatgaacatcgtatgcctcgttaaaaaccttatcagggaaatccaatcagatgaaacctgatgaaggaaaaaagagtgcataacgaacaaaagactgaa |
36002415 |
T |
|
| Q |
216 |
cccttgaaat |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
36002414 |
cccttgaaat |
36002405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 678 times since January 2019
Visitors: 1103