View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0048_low_4 (Length: 293)
Name: NF0048_low_4
Description: NF0048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0048_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 83 - 221
Target Start/End: Complemental strand, 34223619 - 34223482
Alignment:
| Q |
83 |
acaggtagttcgtctgctctgcgatccaacatatcaaatgtttctatgaagctaaataataatttatgaattaggtgctgccgggaatggttgaaagagg |
182 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223619 |
acaggtagttcgtctactctgcgatccaacatatcaaatgtttctatgaagctaaataatgatt-atgaattaggtgctgccgggaatggttgaaagagg |
34223521 |
T |
|
| Q |
183 |
aaagggaacaattctattcactggttgctctgcttcttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223520 |
aaagggaacaattctattcactggttgctctgcttcttt |
34223482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 644 times since January 2019
Visitors: 1100