View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0050-INSERTION3 (Length: 492)
Name: NF0050-INSERTION3
Description: NF0050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0050-INSERTION3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 2e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 16165426 - 16165541
Alignment:
| Q |
7 |
agatcatacacaagatcaggagcactcattttgacaaactatcagcaaacacccaatgcaagacagacgagaagaggttcaactatacaatagagaaagg |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16165426 |
agatcatacacaagattaggagcactcattttgacaaactatcaacaaacacccaattcaagacagacgagaagaggttcaactatgcaatagagaaagg |
16165525 |
T |
|
| Q |
107 |
caagtatcgatgaatg |
122 |
Q |
| |
|
||||||| ||| |||| |
|
|
| T |
16165526 |
caagtatagataaatg |
16165541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 186 - 220
Target Start/End: Original strand, 16165601 - 16165635
Alignment:
| Q |
186 |
tttgcgcaattaacacacttttcattgtagagtat |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16165601 |
tttgcccaattaacacacttttcattgtagagtat |
16165635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 532 times since January 2019
Visitors: 1096