View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0051_low_7 (Length: 310)
Name: NF0051_low_7
Description: NF0051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0051_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 47776084 - 47776297
Alignment:
| Q |
1 |
tcatgtatattaaaatcattaaataaagtgacaatatattatatgattatgtnnnnnnnnnnnntannnnnnngaagaaatgactatgtaaaatatttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
47776084 |
tcatgtatattaaaatcattaaataaagtgacaatatattagatgattatgtaaaaaaaaaaaaaaattt----aagaaatgactatgtaaaatatttgt |
47776179 |
T |
|
| Q |
101 |
ata----tatattcttttattgtgtaaaataattattaagatataacttatgtaattaactagttaataaagataataactcatttagcttaaattatat |
196 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47776180 |
atatatatatattcttttattgtgtaaaataattattaagatatgacttatgtaattaactagttaataaagataataactcatttagcttaaattata- |
47776278 |
T |
|
| Q |
197 |
tttttgtactttaacatta |
215 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
47776279 |
tttttgtattttaacatta |
47776297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1511 times since January 2019
Visitors: 1302