View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0051_low_8 (Length: 249)
Name: NF0051_low_8
Description: NF0051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0051_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 1696117 - 1696050
Alignment:
| Q |
1 |
ctctctctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgttatgctat |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1696117 |
ctctctctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgttatgctat |
1696050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 128 - 200
Target Start/End: Complemental strand, 1695981 - 1695909
Alignment:
| Q |
128 |
atgaaagaatcaaccttagtataccagctatatttagatcaacgattagtctgacataatcatagtttatcac |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1695981 |
atgaaagaatcaaccttagtatacctgctatatttagatcaacgatgagtctgacataatcatagtttatcac |
1695909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 1685568 - 1685520
Alignment:
| Q |
1 |
ctctctctttctctgtttattactttgttttggtgtttacgtgaatata |
49 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1685568 |
ctctctctttctctatttattactttgttttgttgtttacgtgaatata |
1685520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 173
Target Start/End: Complemental strand, 1685447 - 1685404
Alignment:
| Q |
130 |
gaaagaatcaaccttagtataccagctatatttagatcaacgat |
173 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1685447 |
gaaagaatcaacctaagtataccagctatatttagatcaacgat |
1685404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 877 times since January 2019
Visitors: 1286