View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0052_high_14 (Length: 221)
Name: NF0052_high_14
Description: NF0052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0052_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 7 - 90
Target Start/End: Complemental strand, 32425095 - 32425012
Alignment:
| Q |
7 |
caaccaaccattcacagacattatttagaatcaatagcactaacatttctaatggaacgcgtgtcagtgtcccattgattatat |
90 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32425095 |
caaccatccattcacagacattatttagaatcaatagcaccaacatttctaatggaacgcgtgtcagtgtcccattgactatat |
32425012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 118
Target Start/End: Complemental strand, 1542933 - 1542828
Alignment:
| Q |
14 |
ccattcacagacattatttagaatcaatagcactaacatttctaatggaacgcgtgtcagtgtcccat-tgattatattcaaatcacttattttcttaaa |
112 |
Q |
| |
|
||||||||| | ||||||| ||||||||||||| |||||||| ||||||||| ||||| || || ||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
1542933 |
ccattcacatatattatttggaatcaatagcaccaacatttcaaatggaacgtgtgtcggtatcacatgtgattatattcaaataaattattttcttaaa |
1542834 |
T |
|
| Q |
113 |
ttatta |
118 |
Q |
| |
|
|||||| |
|
|
| T |
1542833 |
ttatta |
1542828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University