View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0052_high_4 (Length: 292)
Name: NF0052_high_4
Description: NF0052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0052_high_4 |
 | |
|
| [»] scaffold0252 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0252 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 20799 - 20624
Alignment:
| Q |
1 |
tcccaatcagaccctgaaataatgccaaccacctttttgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtg |
100 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20799 |
tcccaatcagacccttaagtaatgccaaccacctttttgacaacattctgcattgcattctgc------------tcaagcatccctttgtagaaatgtg |
20712 |
T |
|
| Q |
101 |
aaagcgcaacaacatcactcttcaacttctccccttttaaacttgttgaaatcgtcacatgtgtctcttcatctaaatagaacccttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20711 |
aaagcgcaacaacatcactcttcaacttctccccttttaaactccttgaaatcgtcacatgtgtctcttcatctaaatagaacccttt |
20624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 43435316 - 43435132
Alignment:
| Q |
1 |
tcccaatcagaccctgaaataatgccaaccacctttttgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
43435316 |
tcccaatcagaccctgaaataatgccaaccacctttttaacaacattctgcattgcattttgc------------tcaagcatccctttatagaaatgtg |
43435229 |
T |
|
| Q |
101 |
aaagcgcaacaacatcactcttcaacttctccccttttaaacttgttgaaatcgtcacatgtgtctcttcatctaaatagaaccctttatccatcat |
197 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||||| ||| |||| || |||||||||| || ||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
43435228 |
aaagtgcaacaatatcactcttcaaattctcccttttcaaacccgtagaaatcgtcaaatacgtctcttcatctaaataaaaccctttttccttcat |
43435132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 43426811 - 43426639
Alignment:
| Q |
1 |
tcccaatcagaccctgaaataatgccaaccacctttttgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||| |||||||||||||||||| |||||| ||| |
|
|
| T |
43426811 |
tcccaatcagaccctgaaataataccaaccacctttttgacaacactctgcatt------------gcatcctgctcaagcatccctttatagaaacgtg |
43426724 |
T |
|
| Q |
101 |
aaagcgcaacaacatcactcttcaacttctccccttttaaacttgttgaaatcgtcacatgtgtctcttcatctaaatagaaccc |
185 |
Q |
| |
|
|| | |||||||||||||||||| |||| || ||| ||| || |||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
43426723 |
aatactcaacaacatcactcttcatcttcgcctttttcaaatctgccgaaagtatcaaatgtgtctcttcatctaaataaaaccc |
43426639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University