View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0052_low_13 (Length: 281)
Name: NF0052_low_13
Description: NF0052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0052_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 56 - 186
Target Start/End: Complemental strand, 34674353 - 34674220
Alignment:
| Q |
56 |
caaagatctggctgcagcaaagaactacatcat---aaaataaaagcatagaaattgggcaaagccctaaatagtgtcttttcaaaaggatccattttat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34674353 |
caaagatctggctgcagcaaagaactacatcatcataaaataaaggcatataaattgggcaaagccctaaatagtgtcttttcaaaaggatccattttgt |
34674254 |
T |
|
| Q |
153 |
gtcaagcaaccgttactttactcaaaagagcaca |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
34674253 |
gtcaagcaaccgttaccttactcaaaagagcaca |
34674220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University