View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0052_low_34 (Length: 201)
Name: NF0052_low_34
Description: NF0052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0052_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 37 - 182
Target Start/End: Original strand, 22440295 - 22440440
Alignment:
Q |
37 |
gagacgggtgagtgagcatccggaggtgcagatgttgatagaagtggttatgtatttagggaggaaaccgttggctcggtttccttccggggattttgtt |
136 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
22440295 |
gagacgggtgagtgagcatccggaggtgcagatgttgatcgaagtggttatggatttagggaggaaaccgttggctcgttttccttccggggattttgtt |
22440394 |
T |
 |
Q |
137 |
atatcggagtatccaatcactgttgaggatattcagtatgctactg |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22440395 |
atatcggagtatccaatcactgttgaggatattcagtatgctactg |
22440440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University