View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_high_12 (Length: 249)
Name: NF0053_high_12
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0053_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 7545078 - 7544865
Alignment:
Q |
23 |
aaagctttcagcagtcaaaccccatatattaagatctacctcttcaagcttccatctttcttccaattcccttttatgatttgcagattgttctccatat |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7545078 |
aaagctttcagcagtcaaaccccatatattaaaatctacctcttcaagcttccatctttcttccaattcccttttatgatttgcagattgttctccatat |
7544979 |
T |
 |
Q |
123 |
ctagaaacagtaactcgagttgtgccactgtgtgacacatttattccatctacatatttataatcatcaattactgactctagacttgtttcccaaaaaa |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7544978 |
ctagaaacagtaactcgagttgtgccactgtgtgacacatttattccatctacatatttataatcatcaattactgactctagacttgtttcccaaaaaa |
7544879 |
T |
 |
Q |
223 |
tgtcattatcatct |
236 |
Q |
|
|
|||||||||||||| |
|
|
T |
7544878 |
tgtcattatcatct |
7544865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University