View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_high_4 (Length: 393)
Name: NF0053_high_4
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0053_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 30 - 378
Target Start/End: Original strand, 32731943 - 32732293
Alignment:
| Q |
30 |
gtgggtacgtggatgtgtggttgtgactcatgaacccaaccaagtaaggattagattttggatagcattttcattcaatgaatggttgtaattcatgctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731943 |
gtgggtacgtggatgtgtggttgtgactcatgaacccaaccaagtaaggattagattttggatagcattttcattcaatgaatggttgtaattcatgctt |
32732042 |
T |
|
| Q |
130 |
tgtttttgtgcttgtagtaagtccaatcatgaatgtgatcttactctcactcactcannnnnnnc-ctattgtaatatgatggttgggcatgaatcttta |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32732043 |
tgtttttgtgcttgtagtaagtccaatcatgaatgtgatcttactctcactcactcattttttttgctattgtaatatgatggttgggcatgaatcttta |
32732142 |
T |
|
| Q |
229 |
tggcttagattggttttctcgttacatcagtggacaataaaattctgtcaaattatatatttttcctttttatagtttaaacatatataag-atcattgt |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32732143 |
tggcttagattggttttctagttacatcagtggacaataaaattctgtcaaattatataattttcttttttatagtttaaacatatataagaatcattgt |
32732242 |
T |
|
| Q |
328 |
ttttagacttggtatcctccacaaccaactatgaagactaatcatcaggtc |
378 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32732243 |
ttttagacttagtatcctccacaaccaactatgaagactaatcatcaggtc |
32732293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1031 times since January 2019
Visitors: 1289