View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0053_high_8 (Length: 273)

Name: NF0053_high_8
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0053_high_8
NF0053_high_8
[»] chr4 (2 HSPs)
chr4 (1-135)||(1718555-1718690)
chr4 (201-262)||(1718428-1718489)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 1718690 - 1718555
Alignment:
1 tcatatgatctatgaatattagaagttagaaccttcccttaaaaaagaaactagaacc-nnnnnnnnaaggaagaaactagaaccttgttatgtcctatg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||    
1718690 tcatatgatctatgaatattagaagttagaaccttcccttaaaaaagaaactagaacctttttttttaaggaagaaactagaaccttgttatgtcctatg 1718591  T
100 ttaccatnnnnnnntatttatggtgactcctcattg 135  Q
    |||||||       ||||||||||||||||||||||    
1718590 ttaccataaaaaaatatttatggtgactcctcattg 1718555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 201 - 262
Target Start/End: Complemental strand, 1718489 - 1718428
Alignment:
201 gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1718489 gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat 1718428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University