View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_low_13 (Length: 309)
Name: NF0053_low_13
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0053_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 62 - 221
Target Start/End: Original strand, 7150086 - 7150244
Alignment:
| Q |
62 |
caaaggccgcattctattcgagatgtttttcattgtactagtaaagatgctatcattttccattttattctattagtttacaaagtatcaaaataatgaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7150086 |
caaaggccgcattctattcgagatgtttttcattgtactagtaaagatgctatcattttccattttattctattagtttacaaagtatcaaaataatgga |
7150185 |
T |
 |
| Q |
162 |
gcattatgcgattccattaatttggtnnnnnnnntgctcttccattacgactatgattct |
221 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
7150186 |
gcattatgcgattccattaa-ttggtaaaaaaaatgctcttccattacgactatgattct |
7150244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University