View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_low_16 (Length: 273)
Name: NF0053_low_16
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0053_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 1718690 - 1718555
Alignment:
| Q |
1 |
tcatatgatctatgaatattagaagttagaaccttcccttaaaaaagaaactagaacc-nnnnnnnnaaggaagaaactagaaccttgttatgtcctatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1718690 |
tcatatgatctatgaatattagaagttagaaccttcccttaaaaaagaaactagaacctttttttttaaggaagaaactagaaccttgttatgtcctatg |
1718591 |
T |
 |
| Q |
100 |
ttaccatnnnnnnntatttatggtgactcctcattg |
135 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
1718590 |
ttaccataaaaaaatatttatggtgactcctcattg |
1718555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 201 - 262
Target Start/End: Complemental strand, 1718489 - 1718428
Alignment:
| Q |
201 |
gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718489 |
gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat |
1718428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University