View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_low_21 (Length: 245)
Name: NF0053_low_21
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0053_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 45105666 - 45105558
Alignment:
| Q |
121 |
tgtcatttctctgattttattatagacttatttaaatcaaataaattcccaattttccttggttgttagatactccatgtttcgctctaacgtctttgca |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45105666 |
tgtcatttctctgattttattataggcttatttaaatcaaataaattcccaattttccttggttgttagatactccatgtttcgctctaacgtctttgca |
45105567 |
T |
 |
| Q |
221 |
tattttcat |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
45105566 |
tattttcat |
45105558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 7 - 99
Target Start/End: Complemental strand, 45105779 - 45105690
Alignment:
| Q |
7 |
tagatatctttgtttattatgagaagaagaagaagaatgggggagctatattttattaaatagaagaaaataaagaactcaaagtttaggcaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45105779 |
tagatatctttgtttattatgagaagaagaagaa---tgggggagctatattttattaaatagaagaaaataaagaactcaaagtttacgcaa |
45105690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University