View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0053_low_24 (Length: 229)
Name: NF0053_low_24
Description: NF0053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0053_low_24 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 1718968 - 1718746
Alignment:
Q |
7 |
gaggtttcctaggcaatcaattgtgtgtgtatttactatctatattatgatagctaaataaattaaacaaatgacaagttggaatggtaaacattttaaa |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1718968 |
gaggtttcctaggcaatcaattgtgtgtgtatttactatctatattatgatagctaaataaattaaacaaatgacaagttggaatggtaaacattttaaa |
1718869 |
T |
 |
Q |
107 |
aattccattgtcatggctattgtgaatnnnnnnnnnnctattacaacttgctttgcagtttatttaatttatgcgtccataatctcaatccaaatcatgc |
206 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1718868 |
aattccattgtcatggctattgtgaataaaaaaaaaactattacaacttgctttgcagtttatttaatttatgcgtccataatctcaatccaaatcatgc |
1718769 |
T |
 |
Q |
207 |
aattgcaatctgtcattttcgcc |
229 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
1718768 |
aattgcaatctgtcattttcgcc |
1718746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University