View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0054-Insertion-20 (Length: 385)
Name: NF0054-Insertion-20
Description: NF0054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0054-Insertion-20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 11 - 377
Target Start/End: Original strand, 30906563 - 30906930
Alignment:
| Q |
11 |
tatgatattggtatgcatgctctttagtttgttagtgcccatcttttgaggaatgatattaaaacttgtcctcaaataattaatttgattggctagttta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| | |||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
30906563 |
tatgatattggtatgcatgctctttagttttgtggtgcccatcttttcatgaatgatattcaaacttgtcctcaaataatt----tggttggctagttta |
30906658 |
T |
 |
| Q |
111 |
tgggttatatggaaggtgtgtagtctttggatctttcaaaacaaaaagtaagttgcgctcatatggttgttgacaaagtgaaatttccattcttgatggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30906659 |
tgggttatatggaaggtgtgtagtctttggatctttcaaaacaaaaagtaagttgcgctcatatggttg---acaaagtgaaatttccattcatgatggt |
30906755 |
T |
 |
| Q |
211 |
cacttaagatgtatatgcataattctttccttcgattttaatgtctgaaggactaacctatctgtttttattttta--------ttattctaccttgtaa |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30906756 |
cacttaagatgtatatgcctaattctttccttcgtttttaatgtccgaaggactaacctatctgtttttatttttatttttatgttattctaccttgtaa |
30906855 |
T |
 |
| Q |
303 |
catcctttcctgttttatagatagatttgttgtattacaaaactttgtcatgattctttattagacgcatcttgt |
377 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30906856 |
catcgtttcctgtattatagatagatttgttgtattacaaaactttgtcatgattctttattagacgcatcttgt |
30906930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University