View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0054-Insertion-24 (Length: 137)
Name: NF0054-Insertion-24
Description: NF0054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0054-Insertion-24 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 7699752 - 7699880
Alignment:
| Q |
9 |
agctcttccctgcttcttcataatgcaagatgttctaattcataaactaatttctctcttatttaaattgagtgagattatgagtttaattaacttttgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7699752 |
agctcttccctgcttcttcataatgcaagatgttctaattcataaactaatttctctcttatttcaattgagtgagattatgagtttaattaacttttgt |
7699851 |
T |
|
| Q |
109 |
tctttccatttcaattgagttaggttaga |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7699852 |
tctttccatttcaattgagttaggttaga |
7699880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1180 times since January 2019
Visitors: 1293