View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0055_low_8 (Length: 229)
Name: NF0055_low_8
Description: NF0055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0055_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 52 - 211
Target Start/End: Original strand, 35083741 - 35083900
Alignment:
| Q |
52 |
gctccttccccttctcttgcctcttccaacttcctttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35083741 |
gctccttccccttctcttgcctcttccaacttcttttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
35083840 |
T |
 |
| Q |
152 |
aagctgaactatacatttccatagtctgttttagttcaagcttgagcctcctcatctctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35083841 |
aagctgaactatacatttccatagtctgttttagttcaagcttgagcctcctcatctctg |
35083900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 182
Target Start/End: Complemental strand, 42529960 - 42529911
Alignment:
| Q |
133 |
gctgtgagtgcttccttgcaagctgaactatacatttccatagtctgttt |
182 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||||||||||| || ||||| |
|
|
| T |
42529960 |
gctgttagtgcttccttacaagctgtactatacatttccattgtttgttt |
42529911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Complemental strand, 42521755 - 42521715
Alignment:
| Q |
133 |
gctgtgagtgcttccttgcaagctgaactatacatttccat |
173 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42521755 |
gctgttagtgcttccttacaagctgtactatacatttccat |
42521715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University