View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0057_high_14 (Length: 213)
Name: NF0057_high_14
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0057_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 44 - 203
Target Start/End: Original strand, 35083741 - 35083900
Alignment:
Q |
44 |
gctccttccccttctcctgcctcttccaacttcctttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
143 |
Q |
|
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35083741 |
gctccttccccttctcttgcctcttccaacttcttttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
35083840 |
T |
 |
Q |
144 |
aagctgaactatacatttccatagtcttttttagttcaagcttgagcctcctcatctctg |
203 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
35083841 |
aagctgaactatacatttccatagtctgttttagttcaagcttgagcctcctcatctctg |
35083900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 165
Target Start/End: Complemental strand, 42521755 - 42521715
Alignment:
Q |
125 |
gctgtgagtgcttccttgcaagctgaactatacatttccat |
165 |
Q |
|
|
||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
T |
42521755 |
gctgttagtgcttccttacaagctgtactatacatttccat |
42521715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 165
Target Start/End: Complemental strand, 42529960 - 42529920
Alignment:
Q |
125 |
gctgtgagtgcttccttgcaagctgaactatacatttccat |
165 |
Q |
|
|
||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
T |
42529960 |
gctgttagtgcttccttacaagctgtactatacatttccat |
42529920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University