View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0057_high_8 (Length: 319)
Name: NF0057_high_8
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0057_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 94 - 258
Target Start/End: Complemental strand, 40352246 - 40352082
Alignment:
| Q |
94 |
agtttattatcctagagcaagtactcctgagttttgtattaagacttcagctgttaaagctgctatgagaattcaatggtgttctgggatgaggtttaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40352246 |
agtttattatcctagagcaagtactcctgagttttgtattaagacttcagctgttaaagctgctatgagaattcaatggtgttctgggatgaggtttaag |
40352147 |
T |
|
| Q |
194 |
atgccattcgaaaccgaagattcttctaggattagttggttcatgggaactatttcttctgttca |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40352146 |
atgccattcgaaaccgaagattcttctaggattagttggttcatgggaactatttcttctgttca |
40352082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 95 - 258
Target Start/End: Original strand, 21716192 - 21716355
Alignment:
| Q |
95 |
gtttattatcctagagcaagtactcctgagttttgtattaagacttcagctgttaaagctgctatgagaattcaatggtgttctgggatgaggtttaaga |
194 |
Q |
| |
|
||||| ||||| ||||| || ||||||||||| ||| ||||| |||||||||| || ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
21716192 |
gtttactatccaagagctagcactcctgagttctgtgttaaggcttcagctgtgaaggctgctatgaggattcaatggtgttctgggatgaggttcaaga |
21716291 |
T |
|
| Q |
195 |
tgccattcgaaaccgaagattcttctaggattagttggttcatgggaactatttcttctgttca |
258 |
Q |
| |
|
|||| || ||||| ||||| |||||||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
21716292 |
tgccctttgaaactgaagactcttctaggattagttggtttatgggaacaatcgcttctgttca |
21716355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 149 - 237
Target Start/End: Original strand, 51742162 - 51742247
Alignment:
| Q |
149 |
aaagctgctatgagaattcaatggtgttctgggatgaggtttaagatgccattcgaaaccgaagattcttctaggattagttggttcat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||| || ||||||||||| |||||||||||||| |
|
|
| T |
51742162 |
aaagctgctatgagaattcaatggtgttctggtgtga-gtttaagatgccatt--aaactgaggattcttctagtattagttggttcat |
51742247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 98 - 259
Target Start/End: Original strand, 42730665 - 42730826
Alignment:
| Q |
98 |
tattatcctagagcaagtactcctgagttttgtattaagacttcagctgttaaagctgctatgagaattcaatggtgttctgggatgaggtttaagatgc |
197 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||| ||||| ||| | |||||| |||| ||| |||||||||||||||||| ||||| || || |||| |
|
|
| T |
42730665 |
tattatccaagagctagtactcctgaattttgtgttaaggtttcttcagttaaatctgcaatgcaaattcaatggtgttctggtatgagattcaaaatgc |
42730764 |
T |
|
| Q |
198 |
cattcgaaaccgaagattcttctaggattagttggttcatgggaactatttcttctgttcat |
259 |
Q |
| |
|
| || ||||| || ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42730765 |
cttttgaaactgaggattcttctaggattagttggtttatgggaactatttcttctgttcat |
42730826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 801 times since January 2019
Visitors: 1284