View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0057_low_14 (Length: 270)
Name: NF0057_low_14
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0057_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 13394690 - 13394902
Alignment:
| Q |
1 |
atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttttctgttatagaataatgtatttgttttatgatgtgaatttcaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13394690 |
atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttt-ctgttatagaataatgtatgtgttttatgatgtgaatttcaactt |
13394788 |
T |
|
| Q |
101 |
gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13394789 |
gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat |
13394888 |
T |
|
| Q |
201 |
taaatataaaatgt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13394889 |
taaatataaaatgt |
13394902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1329 times since January 2019
Visitors: 1298