View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0057_low_16 (Length: 242)
Name: NF0057_low_16
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0057_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 13394690 - 13394900
Alignment:
Q |
1 |
atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttttctgttatagaataatgtatttgttttatgatgtgaatttcaactt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
13394690 |
atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttt-ctgttatagaataatgtatgtgttttatgatgtgaatttcaactt |
13394788 |
T |
 |
Q |
101 |
gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13394789 |
gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat |
13394888 |
T |
 |
Q |
201 |
taaatataaaat |
212 |
Q |
|
|
|||||||||||| |
|
|
T |
13394889 |
taaatataaaat |
13394900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University