View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0057_low_16 (Length: 242)

Name: NF0057_low_16
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0057_low_16
NF0057_low_16
[»] chr5 (1 HSPs)
chr5 (1-212)||(13394690-13394900)


Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 13394690 - 13394900
Alignment:
1 atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttttctgttatagaataatgtatttgttttatgatgtgaatttcaactt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
13394690 atagggattcaaattcagcactattcacatatatgtgaatgaataatgtatttt-ctgttatagaataatgtatgtgttttatgatgtgaatttcaactt 13394788  T
101 gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13394789 gttacaactagtgcaagaacttgtgtcttgcacgagtttaccccattttctaaatatgtcaataatatctacctaagcatatataatcactgattgtgat 13394888  T
201 taaatataaaat 212  Q
    ||||||||||||    
13394889 taaatataaaat 13394900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1469 times since January 2019
Visitors: 1299