View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0057_low_8 (Length: 367)
Name: NF0057_low_8
Description: NF0057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0057_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 176 - 357
Target Start/End: Original strand, 35084010 - 35084191
Alignment:
Q |
176 |
tcctccaccagaataggatgaatcgaagctgtttcttgcatcgtattcggatgaaagcctaccagtaggatgtccattactaatactactattggagtct |
275 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35084010 |
tcctccaccagaataggatgaagcgaagctgtttcttgcatcgtattcggatgaaagcctaccagtaggatgtccattactaatactactattggagtct |
35084109 |
T |
 |
Q |
276 |
agatcatcattgttatataatgaaggaaatattcgatcaatactcggtcttccactgctcacaaatgatatatctgattcat |
357 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35084110 |
agatcatcattgttatacaatgaaggaaatattcgatcaatactcggtcttccactgctcacaaatgatatatctgattcat |
35084191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 15 - 174
Target Start/End: Original strand, 35083741 - 35083900
Alignment:
Q |
15 |
gctccttccccttctcttgcctcttccaacttcctttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35083741 |
gctccttccccttctcttgcctcttccaacttcttttcttcttcggatctccaacgttgaagctctattgccttctgcttggctgtgagtgcttccttgc |
35083840 |
T |
 |
Q |
115 |
aagctgaactatacatttccatagtctgttttagttcaagcttgagcctcctcatctctg |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35083841 |
aagctgaactatacatttccatagtctgttttagttcaagcttgagcctcctcatctctg |
35083900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 145
Target Start/End: Complemental strand, 42529960 - 42529911
Alignment:
Q |
96 |
gctgtgagtgcttccttgcaagctgaactatacatttccatagtctgttt |
145 |
Q |
|
|
||||| ||||||||||| ||||||| ||||||||||||||| || ||||| |
|
|
T |
42529960 |
gctgttagtgcttccttacaagctgtactatacatttccattgtttgttt |
42529911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 42521755 - 42521715
Alignment:
Q |
96 |
gctgtgagtgcttccttgcaagctgaactatacatttccat |
136 |
Q |
|
|
||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
T |
42521755 |
gctgttagtgcttccttacaagctgtactatacatttccat |
42521715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 682 times since January 2019
Visitors: 1282