View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0058_low_6 (Length: 249)

Name: NF0058_low_6
Description: NF0058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0058_low_6
NF0058_low_6
[»] chr3 (1 HSPs)
chr3 (35-164)||(49290605-49290734)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 35 - 164
Target Start/End: Complemental strand, 49290734 - 49290605
Alignment:
35 gttgcaaatcataatataattattggtcattctcagaacaaccagttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacac 134  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49290734 gttgcaaatcataatataattattggtcatgctcagaacaaccagttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacac 49290635  T
135 aacacttgaccataagaatctttgatgatg 164  Q
    ||||||||||||||||||||||||||||||    
49290634 aacacttgaccataagaatctttgatgatg 49290605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University