View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0058_low_6 (Length: 249)
Name: NF0058_low_6
Description: NF0058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0058_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 35 - 164
Target Start/End: Complemental strand, 49290734 - 49290605
Alignment:
| Q |
35 |
gttgcaaatcataatataattattggtcattctcagaacaaccagttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacac |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290734 |
gttgcaaatcataatataattattggtcatgctcagaacaaccagttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacac |
49290635 |
T |
 |
| Q |
135 |
aacacttgaccataagaatctttgatgatg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49290634 |
aacacttgaccataagaatctttgatgatg |
49290605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University